remB [2018-05-16 18:28:25]

involved in the activation of biofilm matrix biosynthetic operons, acts in parallel to SinR, AbrB, and DegU

locus: BSU00050

pI: 8.80

mw: 5.80 kDa

protein length: 52 aa

gene length: 156 bp

function: regulation of biofilm formation

product: regulator of the extracellular matrix

essential: no

synonyms: yaaB

Genomic Context

categories

• [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
• [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]

Gene

Coordinates: 4,567 → 4,812

Phenotypes of a mutant

• smooth colonies on MsGG medium, no [SW|biofilm formation] [Pubmed|22113911]

Expression and Regulation

Operons

• genes: [gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]-[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]-[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]-[gene|AA42910B71348EFEA4165CFFCEF1E497897B9DDC|gyrB]-[gene|B207C7328177924B16F1C606F667BEADF12CA069|gyrA]
  description: [Pubmed|22383849]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2987848], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

Biological materials

Mutant

• MGNA-B880 (yaaB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1879 NBRP B. subtilis, Japan]
• BKE00050 (Δ[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACAATTGCTCACCTCATT, downstream forward: _UP4_TAGAAATTTTTTATCACGAA
• BKK00050 (Δ[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACAATTGCTCACCTCATT, downstream forward: _UP4_TAGAAATTTTTTATCACGAA

Labs working on this gene/protein

• [SW|Daniel Kearns], Indiana University, Bloomington, USA, [http://www.bio.indiana.edu/facultyresearch/faculty/Kearns.html homepage]

References

• 2987848,19363116